TABLE 3.

Primers and oligonucleotide probes used in this study

Primer or probeTargetTm (°C)aGenBank accession no.Sequence (5′ to 3′)b
Primers
    its1Sb18S68.4 AF455524 19TCCGTAGGGAACCTGCGG37
    its12Ap5.8S64.6 AF455524 211CCAAGAGATCCGTTGTTGAAAG190
    its2Ab5.8S69.1 AF455524 237CGCTGCGYTCTTCATCGATG208
    its3Sb5.8S62.0 AF455524 242GCGATAMGTAATRTGAATTGCAG264
    its23Sp5.8S64.3 AF455524 271GTGAATCATCGARTCTTTGAACG293
    its4Ab28S72.9 L28817 741 GTTGGTTTCTTT TCCTCCGCTTAT TGATATGC710
    SR6RL18S73.5 DQ157694 529CAAACYYGGTCAYTTAGAGGAAGWAAAAGTCGTAACAAGG568
    LR1L28S74.6DQ139803 46CTRRGGCAATCCCDGTTGGTTTCTTTTCCT17
Probes
    CAITS1 of C. albicans68.4 AF455524 149TTTATCAACTTGTCACACCAGA170
    CDITS1 of C. dubliniensis67.3 AJ249485 51 ACATGT GTTTTGTTYTGGACAAACTTG77
    CGITS1 of C. glabrata68.2 AF455515 22 TGTCT GAGCTCGGAGAGAGACATC45
    CGUITS1 of C. guilliermondii67.0 AB105435 107 GCTTTGGTTTGGCCTAGAGATAGGT 131
    CHITS1 of C. haemulonii62.4 AY500375 64GCAACCACCGTTAAGTTCAA83
    CKFITS1 of C. kefyr66.5 AY046214 118 GAG TTTTCYCTATGAACTACTTCCCTGG147
    CKRITS1 of C. krusei64.8 AB054034 95 TGTGGAATATAGCATATAGTCGACAAGAG123
    CLUSITS1 of C. lusitaniae62.6 AY493434 299TGTCAAACACGTTTACAGCACG320
    CNOVITS1 of C. norvegica64.6 AY936525 55TATGCGAGATTGCTTTGGCT74
    CNS1ITS1 of C. norvegensis70.4 AY939799 58 CGTGAGCGCACAACAACAC 77
    CNS2ITS2 of C. norvegensis69.6 AY939799 406GGCCCGCCGAACTTTTTTTT425
    CPITS1 of C. parapsilosis65.1 AF455530 148 C TGCCAGAGATTAAACTCAACCAA171
    CPLITS1 of C. pelliculosa65.21 AF270936 118 YGCCCAAAGGTCTAAACACATTT 140
    CTITS1 of C. tropicalis64.5 AF287910 121 CTACCGCCAGA GGTTATAACTAAACC146
    CUITS1 of C. utilis68.5 AF335929 57 CGGCTCCAACCAATACACAGTG 78
    CVITS1 of C. viswanathii69.9 AY139791 57 GTTTTTTACTGGACAGCTGCTTTGGC 82
    CZITS1 of C. zeylanoides66.7 AF335930 110 GGTCTGACTTAGAAATGAGTTGGGC 134
    CRYITS1 of Cryptococcus neoformans complex64.5 AJ493561 64TTCGGCACGTTTTACACAAAC84
    AFLITS1 of A. flavus67.1 AY373848 174TCTAGTGAAGTCTGAGTTGATTGTATCGC202
    AFUMITS1 of A. fumigatus64.5 AY373851 181GTATGCAGTCTGAGTTGATTATCGTAATC209
    ANIDITS1 of A. nidulans70.1 AY452983 161CTTCATGCCTGAGAGTGATGCAGTC185
    ANIGITS1 of A. niger63.4 AY213633 65CGTGTCTATTATACCCTGTTGCTTC89
    ATERITS1 of A. terreus68.9 AY373871 182CTTGCAGTCTGAGTGTGATTCTTTGC207
  • a T m, melting temperature.

  • b Boldface numbers represent the numbered base positions where the primer or probe sequences start or finish (starting at point 1 of the corresponding gene GenBank sequence). Underlined sequences show bases added to modify previously published probes and primers (28).