TABLE 2.

Description of the primers and probes and their genomic locations for the real-time PCR assays developed in this study

AssaySequence of primer and probe (5′-3′)Locus (or loci) targeted in the complete genome of strains K96243/1710b
8653Forward ATCGAATCAGGGCGTTCAAGBPSS1187/BURPS1710b_A0179, encoding a hypothetical protein
Reverse CATTCGGTGACGACACGACC
FAM-CGCCGCAAGACGCCATCGTTCAT-TAMRA
9438Forward CGATCTCGTCAAGGTGTCGGBPSS2089/BURPS1710b_A1189, encoding a hypothetical protein
Reverse TTGACCTGGATGGCAAAGAAG
FAM-TTGCCTCAGTCACGCGCACGT-TAMRA