TABLE 3.

Primers used for PCR sequencing of nuc, femA, and spa genes

PrimerTargetTm (°C)GenBank accession no.Primer sequence (5′-3′)c
nucS1anuc60.3V01281226ATGACAGAATACTTATTAAGTGCTGG251
nucS2bnuc60.6V01281232GAATACTTATTAAGTGCTGGCATATG257
nucA1bnuc63.9V01281908TGACCTGAATCAGCGTTGTC889
nucA2anuc63.7V01281912TTATTGACCTGAATCAGCGTTG891
femAS1afemA64.1X17688577ATGAAATTAATTAACGAGAGACAAATAGGAG607
femAS2bfemA65.4X17688591CGAGAGACAAATAGGAGTAATGATAATGAAG621
femAA0bfemA67.3X176881868CTGTCTTTAACTTTTTTAAGTGCGGTATATGC1837
femAAafemA68.3X176881878CTAAAAAATTCTGTCTTTAACTTTTTTAAGTGCGG1844
spaSaspa71.7J017861077CTT CAT CCA AAG CCT TAA AGA CGA TCC TTC1106
spaAaspa71.4J017861543CAA TTT TGTCAG CAG TAG TGC CGT TTG1517
spaSEQbspa71.9J017861540TTT TGTCAG CAG TAG TGC CGT TTG CT1515
  • a For most targets, outer primers were used for amplification and, less commonly, for sequencing.

  • b Inner primers were mainly used for sequencing, since they gave better results.

  • c Boldface numbers represent the numbered base positions at which primer sequences start and finish (starting at point “1” of the corresponding GenBank sequence).