TABLE 1.

Locus designations and PCR primer sequences used in this study for the 24-locus set

Set and multiplexaLocusAlias(es)Repeat unit length (bp)bPCR primer pairs (5′ to 3′, with labeling indicated)c
Discriminatory
    Mix 1580MIRU 4; ETR D77GCGCGAGAGCCCGAACTGC (FAM)
GCGCAGCAGAAACGCCAGC
2996MIRU 2651TAGGTCTACCGTCGAAATCTGTGAC
CATAGGCGACCAGGCGAATAG (VIC)
802MIRU 4054GGGTTGCTGGATGACAACGTGT (NED)
GGGTGATCTCGGCGAAATCAGATA
    Mix 2960MIRU 1053GTTCTTGACCAACTGCAGTCGTCC
GCCACCTTGGTGATCAGCTACCT (FAM)
1644MIRU 1653TCGGTGATCGGGTCCAGTCCAAGTA
CCCGTCGTGCAGCCCTGGTAC (VIC)
3192MIRU 31; ETR E53ACTGATTGGCTTCATACGGCTTTA
GTGCCGACGTGGTCTTGAT (NED)
    Mix 3424Mtub0451CTTGGCCGGCATCAAGCGCATTATT
GGCAGCAGAGCCCGGGATTCTTC (FAM)
577ETR C58CGAGAGTGGCAGTGGCGGTTATCT (VIC)
AATGACTTGAACGCGCAAATTGTGA
2165ETR A75AAATCGGTCCCATCACCTTCTTAT (NED)
CGAAGCCTGGGGTGCCCGCGATTT
    Mix 42401Mtub3058CTTGAAGCCCCGGTCTCATCTGT (FAM)
ACTTGAACCCCCACGCCCATTAGTA
3690Mtub3958CGGTGGAGGCGATGAACGTCTTC (VIC)
TAGAGCGGCACGGGGGAAAGCTTAG
4156QUB-415659TGACCACGGATTGCTCTAGT
GCCGGCGTCCATGTT (NED)
    Mix 52163bQUB-11b69CGTAAGGGGGATGCGGGAAATAGG
CGAAGTGAATGGTGGCAT (FAM)
1955Mtub2157AGATCCCAGTTGTCGTCGTC (VIC)
CAACATCGCCTGGTTCTGTA
4052QUB-26111AACGCTCAGCTGTCGGAT (NED)
CGGCCGTGCCGGCCAGGTCCTTCCCGAT
Auxiliary
    Mix 6154MIRU 253TGGACTTGCAGCAATGGACCAACT
TACTCGGACGCCGGCTCAAAAT (FAM)
2531MIRU 2353CTGTCGATGGCCGCAACAAAACG (VIC)
AGCTCAACGGGTTCGCCCTTTTGTC
4348MIRU 3953CGCATCGACAAACTGGAGCCAAAC
CGGAAACGTCTACGCCCCACACAT (NED)
    Mix 72059MIRU 2077TCGGAGAGATGCCCTTCGAGTTAG (FAM)
GGAGACCGCGACCAGGTACTTGTA
2687MIRU 2454CGACCAAGATGTGCAGGAATACAT
GGGCGAGTTGAGCTCACAGAA (VIC)
3007MIRU 27; QUB-553TCGAAAGCCTCTGCGTGCCAGTAA
GCGATGTGAGCGTGCCACTCAA (NED)
    Mix 82347Mtub2957GCCAGCCGCCGTGCATAAACCT (FAM)
AGCCACCCGGTGTGCCTTGTATGAC
2461ETR B57ATGGCCACCCGATACCGCTTCAGT (VIC)
CGACGGGCCATCTTGGATCAGCTAC
3171Mtub3454GGTGCGCACCTGCTCCAGATAA (NED)
GGCTCTCATTGCTGGAGGGTTGTAC
  • a Final concentration of MgCl2 (HotStart buffer already contains 1.5 mM MgCl2) was 1.5 mM in mixes 3, 5, and 7; 2 mM in mixes 2 and 8; 2.5 mM in mix 6; and 3 mM in mixes 1 and 4.

  • b Locus 4 in most clinical isolates contains an additional invariable MIRU of 53 bp in the terminal position of the repeat array. Locus 4052 (QUB-26) displays variant units containing internal deletions in exceptional isolates (reference 39 and our observations).

  • c Compared to the procedure in reference 42, HEX (5′-hexachloro-fluorescein phosphoramidite) labeling has been replaced by VIC labeling. FAM, 6-carboxyfluorescein.