TABLE 2.

Locus designations and PCR conditions for excluded locia

LocusAliasVNTR length (bp)PCR primer pairs (5′ to 3′, with labeling indicated)b
1895QUB-189557GTGAGCAGGCCCAGCAGACT (NED)
CCACGAAATGTTCAAACACCTCAAT
1982QUB-1878CCGGAATCTGCAATGGCGGCAAATTAAAAG
TGATCTGACTCTGCCGCCGCTGCAAATA (NED)
2163aQUB-11a69CCCATCCCGCTTAGCACATTCGTA
TTCAGGGGGGATCCGGGA (FAM)
3232QUB-323256/57TGCCGCCATGTTTCATCAGGATTAA
GCAGACGTCGTGCTCATCGATACA (FAM)
3336QUB-333659AAACAGCACACCGGTGATTTT (VIC)
TTCTACGACTTCGCAACCAAGTATC
  • a The final concentration of MgCl2 was 1.5 mM (HotStart buffer already contains 1.5 mM MgCl2).

  • b FAM, 6-carboxyfluorescein; NED.