TABLE 1.

Oligonucleotide primers used in the study

PCR targetPrimer nameOligonucleotide sequence (5′→3′)Reference or sourcePCR product size (bp)
gyrAGyrA-FCTGAAGCCGGTACACCGTCG6290
GyrA-RTCGGCCATCAGTTCGTGGGC6
gyrBGyrBTyphi-FaTTATCGATGCTGCGCGTGCThis study1,280
GyrB-RTCGCCGCTTTCAGGGCGTTC6
parCParC-FCGCCTACTTAAACTACTCCA6540
ParC-RATCAGCGTAATCGCCGCTTT6
qnrAQnrA-FTCAGCAAGAGGATTTCTCA44625
QnrA-RGGCAGCACTATTACTCCCA44
qnrBQnrB-FGATCGTGAAAGCCAGAAAGG35469
QnrB-RACGATGCCTGGTAGTTGTCC35
qnrSQnrS-FACGACATTCGTCAACTGCAA35417
QnrS-RTAAATTGGCACCCTGTAGGC35
viaB locusTviB-FCGAGTGAAACCGTTGGTACA42846
TviB-RCAATGATCGCATCGTAGTGG42
SPI-7DE0032-FGCTCAGTCGGTAGAGCAGGGGATT421,275b
DE0083-RTCATCTTCAGGACGGCAGGTAGAATG42
  • a Primer GyrBTyphi-F is 1 bp shorter than the forward primer, described elsewhere (6), which is designed to anneal to gyrB of serotype Typhimurium.

  • b If the isolate is SPI-7 negative.