TABLE 1.

Primers used in this study

Primer purposePrimer nameNucleotide sequence (5′-3′)Reference or location on φ108PVL
Subtyping of type IV SCCmec elements
    IV.1 (IVa)4a1TTTGAATGCCCTCCATGAATAAAATOkuma et al. (39)
4a2AGAAAAGATAGAAGTTCGAAAGAOkuma et al. (39)
    IV.2 (IVb)4b1AGTACATTTTATCTTTGCGTAOkuma et al. (39)
4b2AGTCATCTTCAATATCGAGAAAGTAOkuma et al. (39)
    IV.3 (IVc)4c1TCTATTCAATCGTTCTCGTATTTMa et al. (32)
4c2TCGTTGTCATTTAATTCTGAACTMa et al. (32)
    IV.4 (IVd)4d1TTTGAGAGTCCGTCATTATTTCTTMa et al. (32)
4d2AGAATGTGGTTATAAGATAGCTAMa et al. (32)
Identification of virulence factor
    LukS and LukFPVL-FATGTCTGGACATGATCCAAMa et al. (32)
PVL-RAACTATCTCTGCCATATGGTMa et al. (32)
    TSST-1TSST-1ATGATATGTGGATCCGTCATMa et al. (32)
TSST-1BAAACACAGATGGCAGCATMa et al. (32)
    CNAcna-1ACACCAGACGGTGCAACAATTAMa et al. (32)
cna-2AGCAATACCGTTTGCATCTGTTAMa et al. (32)
    SEHentH-FATTCACATCATATGCGAAAGCAGMa et al. (32)
entH-RATGTCGAATGAGTAATCTCTAGMa et al. (32)
Amplification of the whole genome of φ108PVL
    From chromosome to integrasephiMW-DNGCAGAAAAAGATGCGATTGAA
int-RCGGATACAAAGACACTACAAA800-780
    From integrase to antirepressorint-FTTTGTAGTGTCTTTGTATCCG780-800
anti-RCCGAATGTGTGATTGATGTTT5229-5209
    From antirepressor to terminase large subunitanti-FATTGTATTTGCAGATGCAGTAG5001-5022
termi-RTTAATACATCTTCAATGTCTGTC19338-19316
    From terminase large subunit to portal proteintermi-FAAACAAGGTAAGTCTCTAATCG19116-19137
portal-RTCTAAATTAGCATCCGTGATAC21616-21637
    From portal protein to tail proteinportal-FACACGTGATAAAACAGGAGAA21069-21089
tail-RTTCGACTTTTATCTTCGACTTTTC27382-27359
    From tail protein to LukS-PVtail-FTTAAAAGACATGCAAAGAGAGC27566-27587
LukS-RCAGCTTTAGATTCATGAAACGAA42344-42322
    From LukS-PV to chromosomeLukS-FTGGTCAACTATATCGTGGTTTT42038-42059
phiMW-UPTCGCCACGTTTAGCAATTTTAT
Amplification of the leftmost region specific to three extant phages in combination with a primer, int-c
int-cTTTGTAGTGTCTTTGTATCCG
    φPVLrecφPVLTCGAAACCTTATCAAAAGAAACT
    φSLTrecφSLTAAGCTACTGTACAGCGTTATG
    φSa2mwrecφSa2mwAATCTACCTTATCCCGATACGA
Amplification of the rightmost region specific to three extant phages in combination with LukSR listed above
    φPVLφPVL-RETCTTAACTTACCTATTAGAACG
    φSLT, φSa2mwφSLT-MW-REATTACAAGCGTATGACTTATCGA
Amplification of the regions located on φ108PVL
    Aint-F2ATGTTTTCGAGTTTTTGAGTTAG393-415
int-R2CATTTTAATTGCCAGCATCTTA929-950
    Btermi-2GTAGAGGTCAATACAGAATGTT19066-19087
portal-R2AATCTTATGATACGATGTCCC19743-19763
    Cportal-F2ACACGTGATAAAACAGGAGAA21069-21089
portal-RTCTAAATTAGCATCCGTGATAC21616-21637
    Dtail-F2CGTTTGTGGGATAAACTACGTAAT29952-29975
tail-R2TAGTAGTACCGAAATGAAATCTC30386-30408
    Etail-F3CTTGATTAGACTCAACCAAACT31232-31257
tail-R3ATAATTGGGATAGCAACGCAA31704-31725
    F108RE-FAGGCTTCACCCTTACTTATTGA42038-42059
108RE-RGATACCTGATAGCGAATTCG44363-44832