TABLE 1.

PCR primers used for sequencing analysis of class B mec element and ccrA2

TargetPrimerSequence (5′→3′)Location (nt)aReference
IS1272-mecAIS5AACGCCACTCATAACATATGGAA11882-1190423
mA6TATACCAAACCCGACAAC13860-1387717
mecAmAnew1TGGAATTAACGTGGAGACGA13569-13588This study
mAnew2AACGTTGTAACCACCCCAAG15127-15146This study
mecA-IS431mecmA1TGCTATCCACCCTCAAACAGG14861-1488111
IS2TGAGGTTATTCAGATATTTCGATGT18911-1893517
ccrA2ccrA2-FGGATAGGCCCTTCAGGAGTT5785-5804This study
ccrA2-RTGTGCTTTGCATTTCTGTTGA7476-7496This study
  • a Locus of AB245470.