TABLE 1.

A. actinomycetemcomitans serotype-specific PCR assay

AssayPrimerSequenceaSerotypePCR product size (bp)Region amplifiedbGenBank accession no.
1P11TCTCCACCATTTTTGAGTGG (f)b33312780-13112AB002668
P12GAAACCACTTCTATTTCTCC (r)c26812808-13075AB010415
P13CCTTTATCAATCCAGACAGC (f)2324813-5044AF310164
P14ARAAYTTYTCWTCGGGAATG (r)
2P15TGGGTCATGGGAGGTACTCC (f)a2938021-8313AB046360
P16GCTAGGAACAAAGCAGCATC (r)
3P17TGGAACGGGTATGGGAACGG (f)d41111462-12034AB041226
P18GGATGCTCATCTAGCCATGC (r)
4P19ATTCCAGCCTTTTGGTTCTC (f)e31117118-17427AB030032
P20TGGTCTGCGTTGTAGGTTGG (r)
  • a f, forward; r, reverse. R = A or G, Y = C or T, and W = A or T.

  • b GenBank nucleotide sequence coordinates.