TABLE 1.

OADDL case numbers, CPV genotypes, codon usage at critical residues, breeds of dogs affected with CPV, U.S. states of origin of clinical samples, and vaccination histories

SampleCPV typeSequence at critical codonb:BreedStatePrevious vaccination?a
426431440449469494562572
12c GAA CTA GCA AATATTTGTGTAGTAGerman ShepherdTXY
22c GAA CTAACAAATATTTGTGTAGTAMixOKNR
32c GAA CTAACAAATATTTGTGTAGTAPoodleOKY
42c GAA CTAACAAATATTTGTGTAGTALabradorMOY
52bGAT CTG ACAAATATT TGC GTA GTC Yorkshire TerrierMONR
62c GAA CTAACAAATATTTGTGTAGTAChihuahuaOKY
72bGATCTAACAAATATT TGC GTA GTC Scottish TerrierOKNR
82c GAA CTAACAAATATTTGTGTAGTABoston TerrierARNR
92bGATCTAACAAATATT TGC GTA GTC Austrian ShepherdOKY
102bGATCTAACAAATATT TGC GTA GTC PoodleOKY
112c GAA CTAACAAATATTTGT GTG GTACocker SpanielOKY
122bGATCTAACAAAT ATC TGC GTA GTC Jack Russell TerrierOKY
132bGATCTAACAAAT ATC TGC GTA GTC Jack Russell TerrierOKY
142bGATCTAACAAATATTTGTGTAGTAMixGANR
152bGATCTAACA AAC ATT TGC GTA GTC Yorkshire TerrierOKNR
162bGATCTAACAAATATT TGC GTA GTC PapillonKSY
172c GAA CTAACAAATATTTGTGTAGTANRTXY
182bGATCTAACAAATATT TGC GTA GTC BeagleKSY
192c GAA CTAACAAATATTTGTGTAGTABeagleKSY
202bGATCTAACAAATAAT TGC GTA GTC MixKSY
212c GAA CTAACAAATAATTGTGTAGTAMixCAY
222bGATCTAACAAATATT TGC GTA GTC PomeranianMOY
232AATCTAACAAATATT TGC GTA GTC Labrador/poodleKSY
242bGATCTAACAAATATT TGC GTA GTC Great DaneGAY
252c GAA CTAACAAATATTTGTGTAGTAMixFLY
262c GAA CTACCAAATATTTGTGTAGTABoston TerrierMOY
272c GAA CTAGCAAATATTTGTGTAGTASchnauzerALY
282c GAA CTAACAAATATTTGTGTAGTALabrador RetrieverMOY
292c GAA CTAACAAATATTTGTNANAYorkshire TerrierOKY
302c GAA CTA GCA AATATTTGTGTAGTAChihuahuaOKY
312c GAA CTAACAAATATTTGTGTAGTANRILNR
322AATCTAACAAATATTTGTGTAGTANRILNR
332bGATCTAACAAATATT TGC GTA GTC NRILNR
342bGATCTAACAAATATT TGC GTA GTC NRILNR
352bGATCTAACAAATATT TGC GTA GTC Welsh CorgiWAY
362bGATCTAACAAATATT TGC GTA GTC ChihuahuaOKNR
372c GAA CTAACAAATATTTGTGTAGTAYorkshire TerrierOKY
382c GAA CTAACAAATATTTGTGTAGTASchnauzerOKNR
392bGATCTAACAAATATTTGTGTAGTALabrador RetrieverAZY
402bGATCTAACAAATATT TGC GTA GTC Great DaneOKY
412bGATCTAACAAATATT TGC GTA GTC Great DaneOKY
422c GAA CTAACAAATATTTGTGTAGTAYorkshire TerrierOKNR
432c GAA CTA GCA AATATTTGTGTAGTABulldogOKNR
442bGATCTAACAAATATT TGC GTA GTC ChihuahuaOKNR
452bGATCTAACAAATAAT TGC GTA GTC MixGAY
462bGATCTAACAAATAATTGTGTAGTAWelsh CorgiOHY
472AATCTAACAAATAATTGTGTAGTABoxerVAY
482c GAA CTAACAAATAATTGTGTAGTAChihuahuaNRY
492c GAA CTAACAAATAATTGTGTAGTABulldogOKY
502bGATCTAACAAATATT TGC GTA GTC Staffordshire Bull TerrierNCNR
512bGATCTAACAAATAAT TGC GTA GTC Brussels GriffonOKNR
522c GAA CTAACAAATATTTGTGTAGTASchnauzerOKNR
532c GAA CTAACAAATATTTGTGTAGTADachshundOKY
542c GAA CTAACAAATATTTGTGTAGTARottweilerOKY
  • a Y, yes (reported); NR, not reported.

  • b “Third-base” changes at critical codons are boldfaced.