TABLE 1.

Primers and probes used in our singleplex real-time PCR assays for the detection of HHV-6 and GFP

Primer or probeSequence
HHV-6 forward
    primer5′ AAAATTTCTCACGCCGGTATTC 3′
HHV-6 reverse
    primer5′ CCTGCAGACCGTTCGTCAA 3′
HHV-6 probe6-FAM-TCGGTCGACTGCCCGCTACCA-TAMRA
GFP forward
    primer5′ CACCCTCTCCACTGACAGAAAAT 3′
GFP reverse primer5′ TTTCACTGGAGTTGTCCCAATTC 3′
GFP probe6-FAM-TGTGCCCATTAACATCACCATCTAATTCAACA-TAMRA