TABLE 1.

PCR primers and conditions for amplification of STEC virulence genes

GenePrimerOligonucleotide sequence (5′-3′)bFragment size (bp)Annealing temperature (°C)Primer coordinatesGenBank accession no.
stx1VT1-ACGCTGAATGTCATTCGCTCTGC30255113-134M17358
VT1-BCGTGGTATAGCTACTGTCACC394-414
stx2VT2-ACTTCGGTATCCTATTCCCGG5165550-69M59432
VT2-BCTGCTGTGACAGTGACAAAACGC543-565
ehxAHlyA1GGTGCAGCAGAAAAAGTTGTAG155160238-259X79839
HlyA4TCTCGCCTGATAGTGTTTGGTA1767-1788
eaeEAE-1GGAACGGCAGAGGTTAATCTGCAG775551441-1460AF022236
EAE-2aGGCGCTCATCATAGTCTTTC2193-2215
eae-α1EAE-FBAAAACCGCGGAGATGACTTC820601909-1928AF022236
EAE-ACACTCTTCGCATCTTGAGCT2709-2728
eae-α2IH2498aFAGACCTTAGGTACATTAAGTAAGC517602099-2122AF530555
IH2498aRTCCTGAGAAGAGGGTAATC2597-2615
eaeEAE-FBAAAACCGCGGAGATGACTTC830641909-1928AF453441
EAE-BCTTGATACACTTGATGACTGT2718-2738
eae-β1EA-B1-FCGCCACTTAATGCCAGCG811601928-1945AF453441
EAE-BCTTGATACACCTGATGACTGT2718-2738
eae-β2EA-B2-FCCCGCCACTTAATCGCACGT807601929-1948AF043226
EAE-BCTTGATACACCTGATGACTGT2715-2735
eae-γ1EAE-FBAAAACCGCGGAGATGACTTC804601909-1928AF071034
EAE-C1AGAACGCTGCTCACTAGATGTC2691-2712
eae-γ2/θEAE-FBAAAACCGCGGAGATGACTTC808581909-1928AF025311
EAE-C2CTGATATTTTATCAGCTTCA2697-2716
eae-δ/κEAE-FBAAAACCGCGGAGATGACTTC833601909-1928U66102
EAE-DCTTGATACACCCGATGGTAAC2721-2741
eaeEAE-FBAAAACCGCGGAGATGACTTC722661909-1928AF116899
LP5AGCTCACTCGTAGATGACGGCAAGCG2605-2630
eaeZ1GGTAAGCCGTTATCTGCC206622062-2079AF449417
Z2ATAGCAAGTGGGGTGAAG2250-2267
eaeEAE-FBAAAACCGCGGAGATGACTTC712621899-1918AJ308550
LP8TAGATGACGGTAAGCGAC2593-2610
eaeEAE-FBAAAACCGCGGAGATGACTTC807661909-1928AJ308551
LP7TTTATCCTGCTCCGTTTGCT2695-2715
eae68.4FCGGTCAGCCTGTGAAGGGC466642061-2079AF530557
68.4RATAGATGCCTCTTCCGGTATT2506-2526
eaeFV373FCAACGGTAAGTCTCAGACAC44364114-133AJ579305
FV373RCATAATAAGCTTTTTGGCCTACC534-556
eaeIH1229aFCACAGCTTACAATTGATAACA31160269-289AJ579306
IH1229aRCTCACTATAAGTCATACGACT559-579
  • a Universal (detects all types of eae variants) oligonucleotide primer pair EAE-1 and EAE-2 with homology to the 5′ conserved region of eae gene.

  • b The HlyA1 and Hly4 primer pair was designed by Schmidt et al. (45). The remaining primer pairs were designed by us according to the nucleotide sequences of the genes (H88) (Blanco et al., submitted).