TABLE 2.

Primers and probes for gene sequencing and real-time PCR

Gene and groupDesignation5′-3′ nucleotide sequencectrA, sacB, siaD, synF, synG, or xcbBReal-time PCR
Ampli- ficationAnnealing temp (°C)Amplified product size (bp)Sequenc- ingSGS- PCRAmplified product size (bp)Final primer or probe concn (nM)
    ctrAL1289GTCTCTTTAGGGCAACAATCTGA+a551,154+
U157AACTTTTCTTTTTCGGCTTTTTA++
MenXFATGCGGTGGCTGCGGTAGGT+65491+
MenXRCCGGCGAGAACACAAACGACAAG++
F623CCCACCGCACCCATAGACGTA+
R793GTGGCTGCGGTAGGTGGTTCA+
F1097AGGCCACCACCAAACAATACT+
F753TGTGTTCCGCTATACGCCATT+114300
R846GCCATATTCACACGATATACC+900
Pb820AACCTTGAGCAATCCATTTATCCTGACGTTCT+100
sacB (MenA)F21335TAAGTGATTCAGGCGGCATAC+562,041+
R23376CGGCAGCCATTCAACTCAAAT++
F1856TAACAATCAAAACGCAATAGGTGTAT+
F2966AGTAACGGGCTATCTCTATCATCATT+
R1854ACCTATTGCGTTTTGATTGTTAAG+
R2841TGAGGGGAGTGATGTAGTTTAGT+
R2557GAAGGGCACTTTGTGGCATAATTT+
F2531AAAATTCAATGGGTATATCACGAAGA+92300
R2624ATATGGTGCAAGCTGGTTTCAATAG+900
Pb2591CTAAAAGTAGGAAGGGCACTTTGTGGCATAAT+100
slaD (MenB)F2949GGAGACTTCAGCGTCAACGAA+601,647+
R4572TTGTCGGCGGAATAGTAATAATGTT++
F3854TTTGTTAGTCAACGCTACCCCATTTC+
R3854GAAATGGGGTAGCGTTGACTAACAAA+
F3872CCCATTTCAGATGATTTGT+162900
R4013AGCCGAGGGTTTATTTCTAC+900
Pb3974ATGGGCAACAACTATGTAATGTCTTTATT+100
Pb3974(C/T)bATGGG(C/T)AACAACTATGTAATGTCTTTATT+100
siaD (MenC)F109TTTATTATTTCTACATTTGCCCAACT+60990+
R1077CAATTAAAGCGGTGTTCTCTTGT++
F648TTCAGGCGGGATTAGCACAAG+
R648CTTGTGCTAATCCCGCCTGAA+
F478CTTTCCCTGAGTATGCGAAAAAA+77900
R551TGCTAATCCCGCCTGAATG+300
Pb495TTTCAATGCTAATGAATACCACCGTTTTTTTGC+100
synF/G
    (MenW/Y)F85ATCAGAACCTTATTTCAACTATTACT+502,228+
R2288GTCTGCGGATACTCCATTACAATACT++
F827bTCTATTGTTGGCAG(C/T)ATTCAG+
F1267ATATAATCACAATCGCTTCTT+
F1797TACTGATTGCTTTACCCAACA+
F2117ACCGGAAAATGGGAAAAACAC+
R827bCTGAAT(A/G)CTGCCAACAATAGA+
R1267AAGAAGCGATTGTGATTATAT+
R1797TGTTGGGTAAAGCAATCAGTA+
R2117GTGTTTTTCCCATTTTCCGGT+
MenWF1068GTGAGGGATTTCCATATATATTTA+147900
R1214TTGCCATTCCAGAAATATCA+900
Pb1139TATGGAGCGAATGATTACAGTAACTATAA+100
MenYF1019GAGCAGGAAATTTATGAGAATACAGA+140300
R1158CTAAAATCATTCGCTCCATAT+900
Pb1098GTATGGTGTACGATATCCCTATCCTTGCCTATAAT+100
xcbB (MenX)F127TCGTACACTGAATTAGGGGTTA+5183+
R940CGCGAGCTAGATTAGAACT++
F7CCCTCACATCACAGCCTAGTGG+
R937CGCGAGCTAGATTAGAACTTGT+
F173TGTCCCCAACCGTTTATTGG+66900
R237TGCTGCTATCATAGCCGCC+900
Pb196TGTTTGCCCACATGAATGGCGG+100
  • a +, strain was used for this component of the study.

  • b Mixed-base primer or probe.