TABLE 1.

HRV/HEV primers and probes

Primer and/or probeaSequenceb (5′-3′)Position
Real-time RT-PCR
    Primer, forwardCPXGCCZGCGTGGC356-369c
    Primer, reverseGAAACACGGACACCCAAAGTA563-543c
    ProbeTCCTCCGGCCCCTGAATGYGGC444-465c
HRVA 5′NCR sequencing
    Primer, forwardGTACTCTGTTATTCCGGTAACTTTGYAYGCCA49-80c
    Primer, reverseCCAACATTCTGTCTAGATACYTGDGCVCCCAT655-623c
HRVB 5′NCR sequencing
    Primer, forwardACTCTGGTACTATGTACCTTTGTACGCCTGTT48-80d
    Primer, reverseCCACTCTTCTGTGTAGACACYTGDGCDCCCAT661-629d
HRV14 RNA transcript
    Primer, forward, T7 TAATACGACTCACTATAGGGCAAGCACTTCTGTTT179-193d
    Primer, reverse, SP6 ATTTAGGTGACACTATAGAAGCATCTGGTAATTTCC1089-1074d
HEV68 RNA transcript
    Primer, forward, T7 TAATACGACTCACTATAGGGTCTTATGAGCAAGCACT52-68e
    Primer, reverse, SP6 ATTTAGGTGACACTATAGAAATTACTTCAAAATAACTCAG573-554e
  • a Probes were 5′-end labeled with 6-carboxyfluorescein and 3′-end labeled with Black Hole Quencher 1. HRVA, HRV species A; HRVB, HRV species B.

  • b Y = dC or dT; D = dA, dT, or dG; V = dA, dC, or dG; X = LNA-dA; Z = LNA-dT (Glen Research Corporation, Sterling, VA). P is a pyrimidine derivative, a degenerate base mimicking a C/T mix (Glen Research Corporation). Underlined sequences are T7 and SP6 promoter sites.

  • c The nucleotide numbering is based on that of the HRV1B sequence (accession no. D00239).

  • d The nucleotide numbering is based on that of the HRV14 sequence (accession no. K02121).

  • e The nucleotide numbering is based on that of the HEV68 sequence (formerly HRV87) (accession no. AY062273).