TABLE 2.

Oligonucleotides used for PCR or DNA sequencing

GenePrimer sequenceaPosition in Rd genome
adkF: GGTGCACCGGGTGCAGGTAA376521
R: CCTAAGATTTTATCTAACTC375899
pgiF: GGTGAAAAAATCAATCGTAC1644657
R: ATTGAAAGACCAATAGCTGA1645246
recAF: ATGGCAACTCAAGAAGAAAA622556
R: TTACCAAACATCACGCCTAT621940
infBF: TGAAAATGAGCTTGAAGAAGCGG1361550
R: GATAGTTGCCACAGGGCCACGACC1362198
16S rRNAF1: CCAGCAGCCGCGGTAATACG624342
R1: ATCGGYTACCTTGTTACGACTTC625335
F2: GCCCGCACAAGCGGTGGAGCATGTG624751
R2: CTCGTAAGGGCCATGATGACTTGACG625039
igaF: GTTCCACCACCTGCGCCTGCTAC1050386
R: GTTATATTGCCCCTCGTTATTCA1049130
licAbF: GTAGGATTTGTTAAAACTTGCTACAAGCC1608693
R: GGCAATTCCTCTAACAGTTTAAATGCTGCG1609579
lic2AbF: ATATTACATAATATAGAGGAATCTAG571382
R: CTACATAAAACGAACAATTTCTTTACC570690
lgtCbF: CGGACTGTCAGTCAGACAATG289338
R: CTCAAAATGATCATACCAAGATG288499
  • a All oligonucleotides are based on the DNA sequences from H. influenzae strain Rd. F, forward, R, reverse.

  • b The forward primers begin downstream of tetranucleotide repeats.