TABLE 1.

Primers and probes deduced from the M. genitalium MgPa gene sequencea used for TaqMan PCR and primers for construction of the IPC

Primer or probePrimer or probe nameSequencebNucleotide position
Primers for TaqMan assayMgPa-355FGAGAAATACCTTGATGGTCAGCAA1420 in MgPa operon sequence
MgPa-432RGTTAATATCATATAAAGCTCTACCGTTGTTATC1497 in MgPa operon sequence
Primers for construc- tion of IPCMgPa-IPC-FGAGAAATACCTTGATGGTCAGCAATTTCCGGGACGT ATCATGCT13915 in phage lambda sequence
MgPa-IPC-RGTTAATATCATATAAAGCTCTACCGTTGTTATCACCG CTCAGGCATTTGCT14061 in phage lambda sequence
MgPa-380FAM-ACTTTGCAATCAGAAGGT-MGB1445 in MgPa operon sequence
ProbePhage lambda IPC-RTAMRA-TCCTTCGTGATATCGGACGTTGGCTG-BHQ214011 in phage lambda sequence
  • a The GenBank accession number for the M. genitalium MgPa sequence is M31431.

  • b Sequences in boldface correspond to the phage lambda sequence (GenBank accession number J02459). MGB denotes a minor groove binder and a nonfluorescent quencher, and BHQ-2 denotes Black Hole Quencher 2 (nonfluorescent quencher).