TABLE 1.

Primers used in this study

GenePrimer designationPrimer sequence (5′ to 3′)aProduct size (bp)
For cloning into S. aureus RN4220
    erm(A) erm(A)BH+ CAGTGGATCCTCTTATCAAG1,107
erm(A)XB− CTTGTGATCTAGAGAACGC
    erm(C) erm(C)BH+ TTAGATGGATCCCTCATATC999
erm(C) XB− TGCATCTCTAGACTTACTTATT
For sequencing of the translational attenuator
    erm(A) erm(A)1LP+ TTTTTAGTAAAGACAGTGGC481
erm(A)2LP− GTCCTTTTCCTGATCCGA
    erm(C) erm(C)1LP+ TACAAGAAAAAAGAAATTAG327
erm(C)2LP− ATCTATATTATGTTTTGAAG
  • a +, sense primer; −, antisense primer.