TABLE 1.

Primer sequence and repeat unit size of the MIRU loci in this study

MIRU locusPCR primer sequence (5′-3′)Predicted size + additional unit (bp)Amt (pmol) in one PCR tube
MIRU-2TGGACTTGCAGCAATGGACCAACT402 + 534
TACTCGGACGCCGGCTCAAAAT
MIRU-4GTCAAACAGGTCACAACGAGAGGAA114 + 774
CCTCCACAATCAACACACTGGTCAT
MIRU-10GTTCTTGACCAACTGCAGTCGTCC482 + 534
GCCACCTTGGTGATCAGCTACCT
MIRU-16TCGGTGATCGGGTCCAGTCCAAGTA565 + 536
CCCGTCGTGCAGCCCTGGTAC
MIRU-20TCGGAGAGATGCCCTTCGAGTTAG437 + 772
GGAGACCGCGACCAGGTACTTGTA
MIRU-23CTGTCGATGGCCGCAACAAAACG150 + 534
AGCTCAACGGGTTCGCCCTTTTGTC
MIRU-24CGACCAAGATGTGCAGGAATACAT395 + 544
GGGCGAGTTGAGCTCACAGAA
MIRU-26TAGGTCTACCGTCGAAATCTGTGAC285 + 514
CATAGGCGACCAGGCGAATAG
MIRU-27TCGAAAGCCTCTGCGTGCCAGTAA498 + 534
GCGATGTGAGCGTGCCACTCAA
MIRU-31ACTGATTGGCTTCATACGGCTTTA492 + 532
GTGCCGACGTGGTCTTCAT
MIRU-39CGCATCGACAAACTGGAGCCAAAC540 + 534
CGGAAACGTCTACGCCCCACACAT
MIRU-40GGGTTGCTGGATGACAACGTGT354 + 542
GGGTGATCTCGGCGAAATCAGATA