TABLE 2.

List of gene fragments and primer details

GeneDerivationGenBank accession no.Primer sequencesdAmplicon size (bp)Sequence startSequenced fragment (bp)PCR product obtained with group(s)a
5′3′
ACPL Pro-acid proteaseZ11918Fwd, 5′-CTCATTCAAGTCATTAGGCTC-3′ [A1F]660AGAGTTCTTCCTTCGAC548I
Rev, 5′-GCAAGCATTGGCAGTACT-3′ [A1R]
ACPR Pro-acid proteaseZ11919Fwd, 5′-GGAGCTGCTTTCACTATTCG-3′ [A2F]666AAGATACCAAGATACC562I
Rev, 5′-GACAAGTACCATCACCATTT-3′ [A2R]
COX3 b Cytochrome oxidase subunit 3X75679Fwd, 5′-AGGAGATCATACTATTGCAG-3′ [C1F]511TTTGTAGTTAATTATGCTTA380I, II, III
Rev, 5′-TAGTTGTTTCAGCACCA-3′ [C1R]
GAL1 GalactokinaseY14704Fwd, 5′-CCCAAGTTTAACGATTTGTC-3′ [G1F]742TCGAATGGAACCTTGAC624I, III*
Rev, 5′-TAGTGGATCGGAGCCGTT-3′ [G1R]
L1A1 Cytochrome P450 demethylase geneAF019902Fwd, 5′-TGCTCAATTGTATGCTGA-3′ [LIF]675TTTTGTTTTCAGATTTTAC553I, II
Rev, 5′-CCATAATCAACTTCACCTGC-3′ [L1R]
LIP2 Lipase 2AJ320260Fwd, 5′-GGATTGGGGACGTTTCTT-3′ [L2F]618ACCTTGTGGGCAAATAG514I
Rev, 5′-CGTGTTTTTGCAAGTTG-3′ [L2R]
SADH Secondary alcohol dehydrogenaseAB010636Fwd, 5′-GTTGATGCTGTTGGATTGT-3′ [S1F]716GGATTGTGGTTTGATTT546I, II, III
Rev, 5′-CAATGCCAAATCTCCCAA-3′ [SIR]
SAPP3 Secreted aspartic protease 3AF339513Fwd, 5′-TAATTGCTGTCTTCACTGGA-3′ [S2F]537GTGTTTGCTTACTAACC439I, II*, III*
Rev, 5′-AGACCCATGACCCCTTG-3′ [S2R]
SYA1 c Putative alanyl-tRNA synthetaseFwd, 5′-AGAAGAATTGTTGCTGTTACTG-3′ [S3F]543AATATGAACATTGATGC430I, II, III
Rev, 5′-GTTACCTTTACCACCAGCTTT-3′ [S3R]
TOP2 Type II DNA topoisomeraseAB049144Fwd, 5′-GTGAATGCCGCTGATAAC-3′ [T1F]732TAACGTTATGCTCCCAA540I
Rev, 5′-GCCACTTCCCATCTTTC-3′ [T1R]
URA3 Orotidine-5′-phosphate decarboxylaseX99635Fwd, 5′-AGACTTGGGTATTACGTTGT-3′ [U1F]727ATTTTGGCTGATTTAT587I
Rev, 5′-CAGGAGTCATGATTACCC-3′ [U1R]
  • a Asterisked products differed in size between the groups.

  • b Mitochondrial gene.

  • c Primers described for the C. albicans CaSYA1 gene, encoding alanyl-tRNA synthetase.

  • d Fwd, forward; Rev, reverse. Laboratory reference names are given in brackets.